subject
Biology, 09.12.2020 03:40 patrickdolano

PLS HELPPP 2. Sustainable development provides for human needs while still preserving ecosystem services. Do you think hydroelectric power, an important renewable source of electricity world-wide, meets these criteria?

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 22:30
Witch type of microscope is used to view very small cell components like proteins and dna?
Answers: 2
question
Biology, 22.06.2019 01:20
Which organelles are labeled d, and what is one feature that distinguishes them from the other labeled organelles chloroplasts the only organelles that produce sugars from sunlight mosomes, only found in animal and bacterial cells centricles only found in animal cells mitochondra, the only energo-generating structures found in cells
Answers: 1
question
Biology, 22.06.2019 05:40
Benito is doing research on the effects of florida's elevation on its climate. his notes include the following: 1. the average elevation of florida is 30 m above sea level. 2. the highest point in florida is britton hill, which is 105 m above sea level. 3. the change in temperature from 0 m to 1,000 m is 7 °c. what can benito conclude about the effects of florida's elevation on its climate? a.) florida typically experiences cold temperatures and temperature changes within a narrow range. b.) florida typically experiences cold temperatures and temperature changes within a broad range. c.) florida typically experiences warm temperatures and temperature changes within a narrow range. d.) florida typically experiences warm temperatures and temperature changes within a broad range.
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
PLS HELPPP 2. Sustainable development provides for human needs while still preserving ecosystem ser...
Questions
question
Mathematics, 17.05.2021 17:00
question
English, 17.05.2021 17:00
question
Mathematics, 17.05.2021 17:00
question
Mathematics, 17.05.2021 17:00
question
History, 17.05.2021 17:00
question
Chemistry, 17.05.2021 17:00
question
Social Studies, 17.05.2021 17:00
Questions on the website: 13722361