16. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand
5' - AACGGTCCAGTCCAAGTTACG - 3

Biomass can be used to generate electricity. biomass relies heavily on agricultural crops. plants release carbon dioxide and water in combustion. plants use photosynthesis to originally generate the energy that is needed. the chemical energy of these plants all started with what energy source?

Which of the following is a difference between active transport and facilitated diffusion? view available hint(s)which of the following is a difference between active transport and facilitated diffusion? facilitated diffusion can move solutes against a concentration gradient, and active transport cannot.active transport involves transport proteins, and facilitated diffusion does not.facilitated diffusion involves transport proteins, and active transport does not.active transport requires the expenditure of cellular energy, and facilitated diffusion does not.

What macromolecule is produced during translation? a. carbohydrate b. rna c. dna d. protein