Giving brainliest - 6th grade level science Use the weather map to answer the question.

What does the blue line indicate?

1: A cold front is moving to the north and west.

2: A cold front is moving to the south and east.

3: A warm front is moving to the north and west.

4: A warm front is moving to the south and east.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

What is the one part of the nucleotide  that differs among the other different nucle  tides?

Which of the following molecules can be broken down into simple sugars? a. nucleic acid b. protein c. lipid d. carbohydrate