The work of Charles Darwin and Alfred Wallace on the origin of the Earth's species extended the ideas of Lyell's uniformitarianism into the biological sciences. The theory of evolution is based on the principle that the diversity seen in the Earth's species can be
explained by the
es
A)
random variation in the genetics of any population.
B)
idea that in any population, too many individuals are produced.
uniform modification of genetic traits over long periods of time.
D)
sudden change in the gene pool due to mutations within the DNA of a
given population.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?