Biology, 17.12.2020 03:50 itsstaytay200
The work of Charles Darwin and Alfred Wallace on the origin of the Earth's species extended the ideas of Lyell's uniformitarianism
into the biological sciences. The theory of evolution is based on the principle that the diversity seen in the Earth's species can be
explained by the
es
A)
random variation in the genetics of any population.
B)
idea that in any population, too many individuals are produced.
uniform modification of genetic traits over long periods of time.
D)
sudden change in the gene pool due to mutations within the DNA of a
given population.
Answers: 1
Biology, 21.06.2019 21:30
Which best explains why there are 64 possible codons in the genetic code and only 20 amino acids that make protiens of living organisms on earth
Answers: 3
Biology, 22.06.2019 02:00
Ateam from new york presbyterian hospital is conducting a study about a recent increase in cases involving both excess sweating and kidney stones. what would the team need before it draws a conclusion about the cases? medications that are specifically designed to treat the sickness machines that are built to process blood and reduce symptoms until patients are healthy again data that profile the various patients who report these symptoms proof that the excess sweating is related to the excessive kidney stones
Answers: 2
Biology, 22.06.2019 11:30
Use the distance formula to determine weather each pair of segments have the same length
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
The work of Charles Darwin and Alfred Wallace on the origin of the Earth's species extended the idea...
English, 03.10.2019 07:10
Mathematics, 03.10.2019 07:10
English, 03.10.2019 07:10
Mathematics, 03.10.2019 07:10
Mathematics, 03.10.2019 07:10
Mathematics, 03.10.2019 07:10
Mathematics, 03.10.2019 07:10