Although the cause of Parkinson's disease is unknown, research indicates that it may be due to defective nuclei in the cells of those affected. Which of these could be studied as a direct result of having defective nuclei and may shed light on the cause of Parkinson's? es ) A) Enzymes could no longer be produced B) DNA could not be accurately replicated Mitochondria could no longer produce ATP D) Transport across the membrane would be decreased
Answers: 2
Biology, 21.06.2019 16:00
Every compound can be represented by a chemical formula. a chemical formula is the set of symbols showing the elements that make up a compound and their proportions. waterโs chemical formula is h 2 2 o. that means a molecule of water contains two atoms of hydrogen and one atom of oxygen chemically bonded. a molecule is a group of two or more atoms bonded together. molecules can range in size from two to thousands of atoms. a molecule of a compound is the smallest unit of that compound. every molecule of water has all the physical and chemical properties of water. thatโs because every molecule of water is made of the same elements in the same proportions: two hydrogen atoms and one oxygen! which of the following is a true statement? a every molecule of the same compound will have different properties. b every molecule of a compound has the same proportion of elements. c molecules can be physically separated into smaller units of a compound. d molecules cannot be represented by chemical formulae.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:30
Explain how light energy is turned into chemical energy? ! due tomorrow!
Answers: 1
Biology, 22.06.2019 13:00
This rapid change in species that rarely leaves behind fossil evidence is referred to as
Answers: 3
Although the cause of Parkinson's disease is unknown, research indicates that it may be due to defec...
Mathematics, 26.09.2019 03:10
English, 26.09.2019 03:10
Mathematics, 26.09.2019 03:10
History, 26.09.2019 03:10
History, 26.09.2019 03:10
Health, 26.09.2019 03:10
Mathematics, 26.09.2019 03:10
English, 26.09.2019 03:10
English, 26.09.2019 03:20
Mathematics, 26.09.2019 03:21