During prophase I of meiosis, crossing over between the sister chromatids occurs. What is the purpose of this process? To produce genetic variation.
To duplicate the DNA.
To produce the spindle fibers.
To remove the nuclear envelope.

Compare asexual reproduction to sexual reproduction

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Nucleus has two lobes; contains granules of lysosomal enzymes; functions in attacking parasitic worms and plays complex roles in inflammatory diseases like allergies and asthma. what blood cells are described?