If several pea plants with the genotype TTYY are crossed with pea plants witht he genotype TTyy, what percentage of the offspring will be expecgted to have the TTYY allele combination?

Please help I’ll give you brainiest

Casts and mold are a type of preservation where the original material decays, leaving a mold in surrounding rock that can be filled with another sediment a. true b. false

This is the main structural axis of the plant that supports leaves, flowers and fruits; transports fluids; stores nutrients and produces new tissue.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?