Select all the correct answers. This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The red letters are the noncoding region, and the black letters are the protein-coding region.

ATTAGCATACTACGGGC
ATTTGCATACTGACCGGGC
ATTTGCAATACTACCGGGC
ATTTGCAACTACCGGGC
ATGAATGCATACTACCGGGC

the right side of the picture going down is:

polymerase

protein

transport vesicle

modified protein

the left side of the picture going down is:

dna helix

single-stranded rna

endoplasmic reticulum

ribosome

golgi apparatus

protein released from vesicle

click to let others know, how is it

read more on -

surface modification is a versatile tool and has been widely used in material science and engineering that has significantly facilitated the study and characterization of complex materials. at  matexcel, experienced experts in surface science can offer tailored efforts to meet the specific needs from our clients.

here is the answer

water, ice, acids, salts, plants, animals, and changes in temperature are all agents of weathering. weathering is the breaking down or dissolving of rocks and minerals on earths surface. once a rock has been broken down, a process called erosion transports the bits of rock and minerals away.