subject
Biology, 12.01.2021 18:50 JusSomeRandomGuy

3. In which organ does chemical digestion occur?* OA) large intestine
B) esophagus
C) gall bladder
D) small intestine

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 06:00
Most animal cells membranes have proteins that pump ions out of the cell and potassium ions into the cell
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 14:50
Which of the following is not a type of epithelial cell
Answers: 1
question
Biology, 22.06.2019 15:00
Pls me i need this ! each cell has genes activated depending on it's job and what kind of cell it is. it is the presence of that causes the repressor protein to fall off and unblock the gene on the lac operon. if a gene is turned on then it is being an additional circular chromosome found in some bacteria that is used in genetic engineering.
Answers: 2
You know the right answer?
3. In which organ does chemical digestion occur?* OA) large intestine
B) esophagus
C) g...
Questions
question
Mathematics, 28.10.2020 17:10
Questions on the website: 13722363