Biology, 13.01.2021 01:40 emmaraeschool
X-Linked Dominant
Rett syndrome is an X?linked dominant disorder. Model the inheritance pattern of this disorder using uppercase H to represent the dominant allele and lowercase h to represent the recessive allele. Then determine if each of the four possible offspring will express the disease.
PLEASE HELP BRAINLIEST AND 75 POINT FREEBIE TO PERSON WHO CORRECTLY ANSWERS
Answers: 2
Biology, 21.06.2019 23:20
What are the most explosive events that occur on the sun? umbras solar flares solar winds prominences
Answers: 2
Biology, 22.06.2019 07:30
Match the reproductive structures based on their function and the system to which they belong. egg ovary sperm vas deferens vagina fallopian tube testis urethra
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:00
How would you expect the mrna codons that code for the amino acids that make up hemoglobin to compare between humans
Answers: 1
X-Linked Dominant
Rett syndrome is an X?linked dominant disorder. Model the inheritance pattern of...
Mathematics, 17.12.2019 14:31
Geography, 17.12.2019 14:31
English, 17.12.2019 14:31
History, 17.12.2019 14:31
Mathematics, 17.12.2019 14:31
History, 17.12.2019 14:31
Biology, 17.12.2019 14:31
Mathematics, 17.12.2019 14:31
Biology, 17.12.2019 14:31
English, 17.12.2019 14:31