Please Help!
The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is translated. Assume that the sequence is translated from left to right.
AUUUAACUGUUCUGUCUAGAG
1.
Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of amino acids, instead of just one set?
2.
Use Models Use the genetic code to translate the sequence into each of the three possible sets of amino acids.
3.
Draw Conclusions Which of the three sets of amino acids is the most likely to be included in the polypeptide? Explain your reasoning.
Answers: 3
Biology, 22.06.2019 03:30
Recombinant dna (rdna) creates offspring which are genetically identical to the parent is the process of breeding only organisms with desirable traits involves the removal of the nucleus of a cell combines genes from organisms of different species in a lab
Answers: 1
Biology, 22.06.2019 06:30
Is there any solid scientific evidence that humans have been cloned?
Answers: 1
Biology, 22.06.2019 11:30
Which of the following explains why a tree is often used as a model to represent the principle of common descent
Answers: 1
Please Help!
The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more...
Physics, 08.07.2019 10:00
Mathematics, 08.07.2019 10:00
Business, 08.07.2019 10:00
English, 08.07.2019 10:00
History, 08.07.2019 10:00
English, 08.07.2019 10:00