Biology, 15.01.2021 22:40 lexipooh7894
In a heterozygous genotype, the allele takes over in the phenotype.
Answers: 1
Biology, 22.06.2019 04:30
Rachel ate a piece of fruit and happened to drop the seeds in her backyard. after a few weeks, she saw a small plant with flowers growing in the backyard. which group does this plant belong to? a. angiosperms b. gymnosperms c. pteridophytes d. bryophytes e. chytrids
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 18:00
How do bacteria protect their genetic material and cytoplasm during harsh conditions
Answers: 1
Biology, 22.06.2019 18:30
On a spring day, a middle-latitude city (about 40? north latitude) has a surface (sea-level) temperature of 10 ? c. if vertical soundings reveal a nearly constant environmental lapse rate of 6.5 ? c per kilometer and a temperature at the tropopause of –55 ? c, what is the height of the tropopause?
Answers: 3
In a heterozygous genotype, the allele takes over in the phenotype....
Mathematics, 27.09.2021 07:20
Mathematics, 27.09.2021 07:20
Biology, 27.09.2021 07:20
Biology, 27.09.2021 07:20
Spanish, 27.09.2021 07:20
Mathematics, 27.09.2021 07:20
Mathematics, 27.09.2021 07:20
Computers and Technology, 27.09.2021 07:20
History, 27.09.2021 07:20
Mathematics, 27.09.2021 07:20
History, 27.09.2021 07:20
Geography, 27.09.2021 07:20
Biology, 27.09.2021 07:20