Which is one function of a protein macromolecule? A. Providing the building instructions for living things
B. Making up the connective tissue in tendons

Where can a dna be found in a prokaryotic cell

How does the diagram explain ocean currents? earth tilt 23.5 degreesquestion 1 options: earth's tilt causes uneven heating of earth which causes currents.earth's tilt causes the ocean to move because of gravity.earth's tilt and its rotation cause currents.earth's tilt causes uneven distribution of salt which causes currents.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?