Given the following DNA strand TACGTATGCCGTATGGGCATT a) What is the DNA compliment to given strand?

b) What is the mRNA compliment to the given strand?

Clues to ecological principles are given in numerous passages of the bible. a bible study of ecology actually opens the doors to better understanding of god's love and concern for the earth. use a concordance to locate bible passages associated with words concerning our stewardship of the earth. you may use a dictionary to find synonyms for these words: dominion replenish subdue judgment stewardship find each of the passages using these words related to principles of ecology. list all passages by quote, book, chapter, and verse under each word. use your own interpretation to rewrite what you think each verse is saying. after your discussion of each of these words, ask one other person to explain his understanding of the word and a related verse without any hints. summarize what he tells you. a concluding paragraph for each of the words should be written noting similarities and differences between your interpretation and that of each person consulted.

2. which is the last step in the scientific method?

Which substance contains thylakoids? a) nadph b)atp c)stroma d)chloroplast