2
DNA: TTTACGGCCATCAGGCAATACTGG
mRNA:
Codon:
Anitcodon:
Amino Acids:

Which excerpt from the land, part 4 best supports the claim that paul is a talented horseback rider? a/“figure that says more than anything else! now, i want to ride that stallion! " b/my daddy shook his head. "paul only rides horses he knows. ” c/? i glanced over at the other rider. the fellow was older than i, and had the weight of a man on him. d/a man out of alabama, man name of ray sutcliffe, told my daddy i was such a good rider, he wanted me to ride some races for him.

Awave has a wavelength of 15 mm and a frequency of 6 hertz. what is its speed?

What does the positioning of transcription factors determine?