In what way is the DNA of a nerve cell different from the DNA of a muscle cell?
b
Each cell h...
Biology, 26.01.2021 04:00 alyviariggins
In what way is the DNA of a nerve cell different from the DNA of a muscle cell?
b
Each cell has its own unique DNA
The DNA is the same but each cell contains different genes
The DNA is the same but different genes are turned on in each cell,
The DNA is different, but each cell contains the same genes.
d
Answers: 2
Biology, 22.06.2019 01:30
Based on the law of dominance, we would expect percent of the offspring from this cross to have large teeth.
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:50
Interactions between organisms and their environment impact the organismโs overall population. the jaguar panthera onca is the largest cat in north america. it is found in areas across the southwest, including arizona, new mexico, and texas. it is a carnivore that has powerful jaws and sharp teeth and preys on fish, turtles, tapirs, and many smaller mammals. which shows the relationship between the jaguar and turtles?
Answers: 3
Mathematics, 26.07.2021 15:00
Physics, 26.07.2021 15:00
Chemistry, 26.07.2021 15:00
Mathematics, 26.07.2021 15:00
English, 26.07.2021 15:00
Social Studies, 26.07.2021 15:00
Mathematics, 26.07.2021 15:00
Geography, 26.07.2021 15:00
English, 26.07.2021 15:00
English, 26.07.2021 15:00
Mathematics, 26.07.2021 15:00
English, 26.07.2021 15:00
History, 26.07.2021 15:00
Physics, 26.07.2021 15:00