Compare the two DNA strands below to identify the type of mutation that has taken place. DNA strand #1: AACGTTGCGGCCATCGTGCTAATG
DNA strand #2: AACGTTCGGCCATCGTGCTAATGA

When analyzing tree rings, what do scientists assume a thin ring indicates?

Plz fast biotechnology is a growing field of applied biology. many crops such as corn have been engineered to be resistant to herbicides. therefore farmers can spray these chemicals to kill weeds growing near the crop without worries of killing the crop itself how does this type of biotechnology work? a. by changing the genetic make up of the crops. b. by causing the crops to kill the weeds. c. by changing the type of crops used. d. by changing the location of the crops.

Patient has just received an organ transplant which treatment would be most effective in preventing the patient’s body from