Biology, 09.02.2021 04:50 proudmarinemom7186
What is the function of the radula in gastropods? It is used like a nose to sense nearby food. It is used like a tongue to test the taste of food. It is used like teeth to scrape and tear food.
Answers: 3
Biology, 21.06.2019 16:00
Which of the following is a main difference in cell structure between an onion cell and a human cheek cell? a. an onion cell contains one nucleus, whereas a human cheek cell contains two nuclei. b. an onion cell has a cell wall. c. a human cheek cell contains chloroplasts. d. there is no difference between an onion cell and a human cheek cell. you for your.
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:00
As molecules are formed from metabolism, entropy __ and the universe becomes less disordered. a. is decreased b. is increased c. moves closer to equilibrium d. is unchanged
Answers: 3
Biology, 22.06.2019 13:00
In trying to determine whether dna or protein is the genetic material, hershey and chase made use of which of the following facts? a) dna contains sulfur, whereas protein does not. b) dna contains phosphorus, whereas protein does not. c) dna contains nitrogen, whereas protein does not. d) dna contains purines, whereas protein includes pyrimidines.
Answers: 3
What is the function of the radula in gastropods? It is used like a nose to sense nearby food. It is...
Mathematics, 23.04.2021 18:10
Chemistry, 23.04.2021 18:10
Mathematics, 23.04.2021 18:10
Mathematics, 23.04.2021 18:10
Mathematics, 23.04.2021 18:10
Mathematics, 23.04.2021 18:10
Mathematics, 23.04.2021 18:10
Chemistry, 23.04.2021 18:10
Mathematics, 23.04.2021 18:10
Mathematics, 23.04.2021 18:10
Mathematics, 23.04.2021 18:10
Mathematics, 23.04.2021 18:10