Now that you’ve collected the information needed to answer your questions it’s time to organize it keep his guidelines for writing a five paragraph essay in mind as you are on your paper can you show me support the claim you made in the introduction and include a work cited page at the end of the paper wright an out line I for your paper in the space provided remember right now you are just creating a structure for your paper And not actually writing it GRADED CORSE ACTIVITY- Identifying adaptions
Answers: 1
Biology, 22.06.2019 07:00
Dna replication or repair occurs in a cell in all of thw following situations except when
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Now that you’ve collected the information needed to answer your questions it’s time to organize it k...
Chemistry, 16.01.2021 03:50
Mathematics, 16.01.2021 03:50
Computers and Technology, 16.01.2021 03:50
World Languages, 16.01.2021 03:50
Advanced Placement (AP), 16.01.2021 03:50
Mathematics, 16.01.2021 03:50
Mathematics, 16.01.2021 03:50
Chemistry, 16.01.2021 03:50