How do changes in the HBB gene affect body function? Place phrases into the table in the correct order to explain how changes in the HBB
gene affect body tissue function.
Step
Sequence of How Changes in HBB Gene Affect Body Tissue Function
1
2
3
4
Mutation occurs in DNA sequence
Abnormally shaped amino acids form
Mutation occurs during protein folding
Abnormal sequence of amino acids forms
Proteins that form are abnormal in shape and behavior
Cell shape is irregular, resulting in abnormal cell and tissue function
Answers: 2
Biology, 21.06.2019 20:00
What are two reasons for why a species might disappear from the fossil record?
Answers: 1
Biology, 22.06.2019 00:10
Why does meiosis produce cells with half the chromosomes? o a. most of the chromosomes are not necessary to keep an organism alive. b. a gamete needs only half the number of chromosomes because two gametes join together. o c. it makes the gametes easier to move around in the organism. o d. it is faster to produce gametes with fewer chromosomes.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
How do changes in the HBB gene affect body function? Place phrases into the table in the correct ord...
Mathematics, 13.10.2020 09:01
Mathematics, 13.10.2020 09:01
Mathematics, 13.10.2020 09:01
Health, 13.10.2020 09:01
Mathematics, 13.10.2020 09:01
Mathematics, 13.10.2020 09:01
Mathematics, 13.10.2020 09:01
Arts, 13.10.2020 09:01
Mathematics, 13.10.2020 09:01
Spanish, 13.10.2020 09:01
Mathematics, 13.10.2020 09:01
Mathematics, 13.10.2020 09:01