subject
Biology, 18.02.2021 19:10 scarlettlackey

In the southeastern United States, there is a small type of lizard called a fence lizard. They have short legs and live under leaves and dead logs. Over the last 70 years, fire ants have moved into the lizard's environment. When fire ants sting the lizards on their body, the lizards can die
Scientists have observed that in places with fire ants and lizards living together for a long time, the lizards have longer legs. In places where fire
ants have only been there a short time, the lizards' legs are shorter overall
Fire ants move into a new environment with the lizards. What will most likely happen to the lizard population over the next several years?
A. Some of the lizards would try to develop new traits to avoid the ants, and they would pass on those traits to their
offspring. The other lizards would die
B. All of the lizards would try to develop new traits to avoid the ants. They would all survive and pass on those traits to
their offspring
OC. Due to random mutations, some lizard offspring are born with different traits that help them avoid the fire ants. These
offspring will most likely survive and reproduce, while the lizards born without those traits will die.
Select an answer
Back
Open notes navigator
o
M

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 23:30
Considering the yellow and green pea color phenotypes studied by gregor mendel: a. what is the biochemical function of the protein that is specified by the gene responsible for the pea color phenotype? (1 point) b. a null allele of a gene is an allele that does not specify (or encode) any of the biochemical function that the gene normally provides (in other words, either no protein at all or only non-functional protein is produced from it). of the two alleles, y and y, which is more likely to be a null allele? (1 point) c. in terms of the underlying biochemistry, why is the y allele dominant to the y allele? (2 points) d. why are peas that are yy homozygotes green? (1 point) e. the amount of protein produced from a gene is roughly proportional to the number of functional copies of the gene carried by a cell or individual. what do the phenotypes of yy homozygotes, yy heterozygotes, and yy homozygotes tell us about the amount of sgr enzyme needed to produce a yellow color? explain your reasoning. (2 points)
Answers: 1
question
Biology, 21.06.2019 23:30
Sweating and breathing is an example of differentiation specialization maintaining homeostasis metabolism
Answers: 2
question
Biology, 22.06.2019 05:50
Below are the three main organs that make up the plant body. what is the main function of the structure that is identified as b in the picture above? it anchors the plant.it produces food.it absorbs nutrients.it supports the plan
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
In the southeastern United States, there is a small type of lizard called a fence lizard. They have...
Questions
question
Chemistry, 03.11.2020 19:40
question
English, 03.11.2020 19:40
Questions on the website: 13722359