![subject](/tpl/images/cats/biologiya.png)
Biology, 20.02.2021 01:00 Islandgirl67
Predict the most likely effect on cell division for a cell containing DNA with double-strand breaks. Justify your prediction.
![ansver](/tpl/images/cats/User.png)
Answers: 3
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Animals that have thick fur and ae able to store large amounts of body fat live where ?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 13:30
La glucosa es el nutriente mas utilizado por las celulas en la respiracion celular en esta ocurre 4 fenomenos cuales son
Answers: 2
You know the right answer?
Predict the most likely effect on cell division for a cell containing DNA with double-strand breaks....
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 19:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 19:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 19:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 19:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 19:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 19:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 19:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 19:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 19:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 19:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 19:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 19:01
![question](/tpl/images/cats/en.png)
English, 16.09.2020 19:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 19:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 19:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 19:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 19:01
![question](/tpl/images/cats/geografiya.png)
Geography, 16.09.2020 19:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 19:01
![question](/tpl/images/cats/en.png)
English, 16.09.2020 19:01