AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Which statement is not an accurate description of meiosis? a) meiosis produces offspring that are genetically diverse. b) meiosis produces offspring that are identical to the parent. c) in sexual reproduction half of the genetic material comes from the father (sperm) and half of the genetic material comes from the mother (egg). d) meiosis decreases the number of chromosomes by half so that when a sperm fertilizes an egg, the resulting zygote has the correct number of chromosomes.