Biology, 24.02.2021 21:10 Galycon12

Can someone help me with this please!!

Answers: 1

Show answers

Another question on Biology

Biology, 21.06.2019 20:10

Chalk is an ionic compound. which is a property of all ionic compounds that makes chalkboard? particularly useful for writing on a a high melting point hardness and brittleness inability to dissolve in water a multicolored appearance

Answers: 1

Answer

Biology, 21.06.2019 22:00

(drag each tile to the correct identify which questions can be answered by what can be answered by science or which cannot. -is it right or wrong to use genetic engineering to produce new food products? -what are the most common social settings that tend to produce accomplished artists? -if a new gene is added to the genome of a tomato species, will that species be more resistant to insects? -should humans use biotechnology to bring extinct organisms from the fossil record back to life? -do the types of organisms found in the fossil record appear in consistent sequences in different parts of the world? -are michelangelo's paintings more impressive than rembrandt's?

Answers: 3

Answer

Biology, 22.06.2019 02:30

How can antibodies "remember" a particular bacterial invader or "antigen" on that invader?

Answers: 3

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

You know the right answer?

Can someone help me with this please!!
...

Questions