WILL GIVE BRANLIEST !
Case #28104
Last month, Hudson National Bank was robbed by an unidentif...
![subject](/tpl/images/cats/biologiya.png)
Biology, 25.02.2021 21:10 eweqwoewoji
WILL GIVE BRANLIEST !
Case #28104
Last month, Hudson National Bank was robbed by an unidentified man. The robber wore gloves, a hat, and a bandana that covered his face. A security guard attempting to stop the robber was knocked unconscious in a struggle. However, the guard managed to pull the hat from the robber's head. Witness accounts and security tapes led police to arrest three possible suspects. None of the suspects have alibis, but police are not certain which man is the robber. Using hair samples from the hat recovered by the security guard, the crime lab did a Southern Blot test. Hair samples were also taken from each suspect. Use the suspects' hair samples to determine the guilty party.
Part Two
Copy the DNA sequences for each suspect into a Word document.
Use your special enzyme to cut each sequence at the forward slash marks (/). (You can do this by putting spaces after each slash mark.)
Arrange the DNA cuttings in order from shortest to longest. Attach them to a special piece of nitrocellulose paper (construction paper).
Compare the probe base pair sequence with a DNA sample taken from Suspect A. Use a highlighter or different color font to mark any sequences that match the probe.
Repeat step 1 with the DNA samples for Suspects B and C.
Suspect A
TCCATCCA / TCCATCCATCCA / TCCA / GGCTTACCTATAAGG / TGGATGGATGGATGGATGGA
Suspect B
TCCATCCA / TCCATCCAATTG / TCCA / TCCATCCATCCATCCATCCA / TGGATGGATGGATGGA
Suspect C
TTAGCTA / CCGGTATGA / AGGT / CGTTATCGGATATA / GGTTAGGACCTATCGATAGA
Probe
AGGT
Questions
Answer these following questions in the essay box below.
1. Which suspect most likely committed the robbery?
2. How do you know?
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 03:00
Question#29: why does the tropical ocean have a greater temperature range than the temperate ocean?
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 04:30
African penguins, which inhabit the coasts of southern africa, were classified as an endangered species in 2010. two significant threats to their survival are ecosystem damage from oil spills and overfishing by humans. overfishing depletes the food supply of african penguins. the best method to reduce the threat of overfishing would be to . the risk of oil spills could be reduced by increasing the use of , which should oil consumption. if an oil spill does occur, could be used to remove the oil so the ecosystem may more quickly recover.
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 22:00
Which of the following would be most useful for detecting the brain areas that are most active as a person performs mathematical calculations? a. a brain lesionb. an interneuronc. a pet scand. a hemispherectomy
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 22:30
What is a food web? a. the structure used to trap food b. a set of complex carbohydrates c. a group of interconnected food chains d. the pattern of food nutrition
Answers: 2
You know the right answer?
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 09.12.2020 23:50
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 09.12.2020 23:50
![question](/tpl/images/cats/mat.png)
Mathematics, 09.12.2020 23:50
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 09.12.2020 23:50
![question](/tpl/images/cats/istoriya.png)
History, 09.12.2020 23:50
![question](/tpl/images/cats/mat.png)
Mathematics, 09.12.2020 23:50
![question](/tpl/images/cats/mat.png)
Mathematics, 09.12.2020 23:50
![question](/tpl/images/cats/geografiya.png)
Geography, 09.12.2020 23:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
English, 09.12.2020 23:50
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 09.12.2020 23:50
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 09.12.2020 23:50
![question](/tpl/images/cats/mat.png)
Mathematics, 09.12.2020 23:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/ap.png)
Advanced Placement (AP), 09.12.2020 23:50