Summarise the area of biological research carried out by each institution
...
Answers: 2
Biology, 22.06.2019 11:30
There are multiple lines of evidence that provide support for common ancestry and evolution. write 3-4 paragraphs describing at least three of them in detail. provide at least one example for each line of evidence.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:00
What is the role of dna ligase in the elongation of the lagging strand during dna replication?
Answers: 1
Biology, 22.06.2019 13:30
Where is most of the fresh water on earth found a in the ocean b in glaciers and in ice caps c in rivers d in the soil
Answers: 1
English, 02.02.2021 19:20
Spanish, 02.02.2021 19:20
Mathematics, 02.02.2021 19:20
German, 02.02.2021 19:20
Mathematics, 02.02.2021 19:20
Mathematics, 02.02.2021 19:20
Biology, 02.02.2021 19:20
English, 02.02.2021 19:20
Biology, 02.02.2021 19:20