subject
Biology, 03.03.2021 22:30 cieswa46054

When Mendel crossed hybrid pea plants, he observed that certain traits would appear in the next generation more often than others. He also observed that traits did not show up in offspring in predictable combinations. For example, not all tall plants had green peas, while not all short plants had yellow peas. Which term describes this observation?


When Mendel crossed hybrid pea plants, he observed that certain traits would appear in the next gen

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:30
Which of the following is true of metabolism in its entirety in all organisms? a) metabolism depends on a constant supply of energy from food. b) metabolism uses all of an organism's resources. c) metabolism consists of all the energy transformation reactions in an organism. d) metabolism manages the increase of entropy in an organism.
Answers: 1
question
Biology, 22.06.2019 22:30
How would the function of synovial joints be changed if they lacked joint cavities and the bones were united instead?
Answers: 1
question
Biology, 23.06.2019 00:10
Which organelle in a eukaryotic cell is most noticeable under a microscope? nucleus nucleolus ribosome nuclear envelope
Answers: 1
You know the right answer?
When Mendel crossed hybrid pea plants, he observed that certain traits would appear in the next gene...
Questions
question
Mathematics, 18.04.2020 01:01
question
Advanced Placement (AP), 18.04.2020 01:01
question
History, 18.04.2020 01:01
Questions on the website: 13722361