subject
Biology, 18.03.2021 03:00 china236

Match the following vocabulary words. 1. thin tissue covering lungs and thorax
alveoli
2. breathing in
pleura
3. air sacs in the lungs
inspiration
4. back of the mouth
expiration
5. "chest area"
pharynx
6. breathing out
thorax

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 06:00
How can you tell the difference between rough er from smooth er?
Answers: 2
question
Biology, 22.06.2019 09:30
Describe your dna model. which part do the straws represent? the pushpins? the paper clips and the black dots you made with the marker?
Answers: 2
question
Biology, 22.06.2019 11:00
What happens during the experiment stage of the scientific method
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Match the following vocabulary words. 1. thin tissue covering lungs and thorax
alveoli
Questions
question
History, 26.09.2019 13:50
question
Geography, 26.09.2019 13:50
Questions on the website: 13722363