![subject](/tpl/images/cats/biologiya.png)
Biology, 24.03.2021 18:20 kenziekey831
Which organism in this food web has the greatest influence on the ecosystem?
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 03:30
What is the most appropriate method of gaining weight (muscle mass)
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 11:00
Fill in the blank 1. digestion occurs in the small intestine through the action of enzymes. 2. urea, excess water, and other waste materials are eliminated in a water fluid called 3. can cause infections by injecting dna or rna into hosts. 4. the human immune system produces in response to a vaccine, which later can bind to and destroy a pathogen if it invades. 5. are structures that link bone to bone at a joint 6. in the heart, blood flows from the right atrium to the right ventricle, where it is pumped to the the words i can use are: lymphocytes gliding pivot gas urine absorption dermis fulcrum lungs chemical viruses capillary vertebrae esophagus tendons antibodies synapses ligaments kidneys pathogens
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Which organism in this food web has the greatest influence on the ecosystem?...
Questions
![question](/tpl/images/cats/geografiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 08.10.2019 21:00
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/ekonomika.png)
Business, 08.10.2019 21:00
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/istoriya.png)
History, 08.10.2019 21:00
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
English, 08.10.2019 21:00
![question](/tpl/images/cats/istoriya.png)
History, 08.10.2019 21:00
![question](/tpl/images/cats/fizika.png)
Physics, 08.10.2019 21:00
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 08.10.2019 21:00
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/mat.png)