Breaking the Code
REPLICATION:
For each of the three DNA sequences below, write the sequence...
Biology, 30.03.2021 16:20 psychocatgirl1
Breaking the Code
REPLICATION:
For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results after
replication.
DNA molecule #1:
TACCGGATGCCAGATCAAATC
Complimentary DNA #1:
DNA molecule #2:
TACCGTAACCACAACT
Complementary DNA #2:
DNA molecule #3:
TACCTGTTAAGCTACTT
Complementary DNA #3:
Answers: 2
Biology, 21.06.2019 17:30
Which technically is nasa developing that will astronauts reach mars
Answers: 1
Biology, 22.06.2019 01:20
Look at the photo of the leaf. which term best describes this leaf?
Answers: 2
Biology, 22.06.2019 05:00
2. if someone had the list of traits you provided in question 1, do you think he or she would be able to find you in a group of 1000 people? why or why not? if not, what other information encoded in your genes might distinguish you from the others in the group? what are other traits that are encoded for by dna?
Answers: 3
Biology, 22.06.2019 12:30
No plagiarizing ! 6th grade work! easy and 100 compare the parts of a cell and the cell as a whole to another common nonliving system (i.e., a car, a city, describe the parts of a cell and their primary function.
Answers: 1
Biology, 02.08.2019 07:30
History, 02.08.2019 07:30
Biology, 02.08.2019 07:30
Mathematics, 02.08.2019 07:30
Mathematics, 02.08.2019 07:30
Mathematics, 02.08.2019 07:30
Chemistry, 02.08.2019 07:30
Mathematics, 02.08.2019 07:30
Mathematics, 02.08.2019 07:30
French, 02.08.2019 07:30