Biology, 01.04.2021 01:00 reneewilliams20
The leaf color of a certain plant is controlled by one gene. For that gene, the allele G = orange and g = green. You have a plant with orange leaves but do not know whether that plant's genotype is GG or Gg. Which of the following would help you determine the plant's genotype?
•cross the plant to another plant with orange leaves
•cross 2 true-breeding, orange-leaved plants to each other and then cross one of their offspring to the plant with the unknown genotype
•cross the plant with green leaves
•change the environment in which the plant grows to find the conditions that cause the leaves to produce the orange color
Answers: 3
Biology, 22.06.2019 02:30
What are simmilarities and differences between anaerobic respiration in animal and yeast cells? would prefer to get simmilarities as i already got some differences. you!
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:40
In a cladogram, what occurs at a node? a derived trait appears. evolution is stopped. an ancestor dies. the cladogram ends. aa as s as ss what are the chances that their offspring will have sickle cell anemia? 0% 25% 50% 100%
Answers: 3
The leaf color of a certain plant is controlled by one gene. For that gene, the allele G = orange an...
Advanced Placement (AP), 25.03.2021 20:10
Mathematics, 25.03.2021 20:10
English, 25.03.2021 20:10
Mathematics, 25.03.2021 20:10
Mathematics, 25.03.2021 20:10
Mathematics, 25.03.2021 20:10
Social Studies, 25.03.2021 20:10
Mathematics, 25.03.2021 20:10