Gene Editing in Primary T Cells Creative Biogene CRISPR/Cas9 Platform provides comprehensive gene editing services for various cell lines, especially for primary T cells. With years of experience, our talented scientists have established an efficient assay to edit genome in T cells by CRISPR/Cas9. At CRISPR/Cas9 PlatformCB, we offer a gene knockout service for customer as well as isolation of primary T cell service. Based on our excellent platform, our staff are focusing on supplying the best services and products.

https://www. creative-biogene. com/crispr-cas9/service/gene-editin g-in-primary-t-cells. html

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?