1. restriction enzymes are
naturally occurring proteins
genetically engineered proteins<...
1. restriction enzymes are
naturally occurring proteins
genetically engineered proteins
enzymes that cut proteins
b then c
a then c
2. plasmids
can be used to cut dna
can be used to insert dna into bacteria
can be used to digest proteins
a and c
all of the above
3. name the technique used to increase a quantity of dna.
plastid technology
genetic engineering
pcr
rna
recombinant dna technology
4. what tool does one use to separate dna fragments?
an electron microscope
a cyclotron
a mass spectrograph
a polyacrylamide gel
a centrifuge (high speed)
5. dna fragments hav
1. restriction enzymes are
naturally occurring proteins
genetically engineered proteins
enzymes that cut proteins
b then c
a then c
2. plasmids
can be used to cut dna
can be used to insert dna into bacteria
can be used to digest proteins
a and c
all of the above
3. name the technique used to increase a quantity of dna.
plastid technology
genetic engineering
pcr
rna
recombinant dna technology
4. what tool does one use to separate dna fragments?
an electron microscope
a cyclotron
a mass spectrograph
a polyacrylamide gel
a centrifuge (high speed)
5. dna fragments hav
Answers: 2
Biology, 22.06.2019 05:20
Match the description of each organism to the appropriate category
Answers: 2
Biology, 22.06.2019 07:00
What was the purpose of mendel's experiments with dihybrid crosses? a. to determine if dna was a transforming factor b. to determine if traits could be recessive c. to determine if traits affected each other d. to determine if traits had more than one allele
Answers: 3
Biology, 22.06.2019 08:00
Can create a hboth of these instruments can measure wind speed. doppler radar and psychrometer anemometer and hygrometer doppler radar and anemometer radiosonde and psychrometer
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
SAT, 23.02.2022 14:00
Social Studies, 23.02.2022 14:00
Chemistry, 23.02.2022 14:00
Advanced Placement (AP), 23.02.2022 14:00
Mathematics, 23.02.2022 14:00
History, 23.02.2022 14:00