Completa las siguientes hebras de ADN 5' ATCGTACGTAGCTACGTAGCT 3'
5' GGTATTACGGGCTTAGGCGCCCAA 3'
5' AATTCGGGATTCCATTGCTGAC 3'

Asegment of dna that codes for rna and a protein is a

One of the newest applications of cell technology is called cybrid embryos. this process involves replacing the nuclear material of an animal cell with human nuclear material. how might this process affect public policies about research by using stem cells? the same policies and concerns about the use of human embryonic stem cells would most likely apply. the embryos would most likely be treated like traditional animal embryos and regulated accordingly. the process of forming cybrid embryos would most likely be banned by government regulators. the embryos would be treated as regular cells because they are not fully human in origin.

All other things being equal the size of a population will decrease if