![subject](/tpl/images/cats/biologiya.png)
Biology, 15.04.2021 01:00 pim9705876
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACCGTAACCACAACT and TACCTGTTAAGCTACTT?
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 00:00
In which situations is the principle of cross-cutting relationship useful in determining relative age?
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 02:00
Consider the motion of the balloon and its air contents in terms of momentum. in step 1 above, the total momentum of the balloon and its contents was zero. recall that momentum = mv. both the balloon and the air inside it had a velocity of zero and therefore the total momentum was zero. now think about what happened when the air escaped from the balloon. a certain mass of air accelerated in one direction. in order to keep the total momentum of the system zero, the balloon itself (which has mass) had to accelerate in the opposite direction. use this scenario to you explain why the soda can rotates when the water squirts out of the escape holes. what was your hypothesis concerning the water-filled can? according to your data, do you think your hypothesis was correct? (be sure to refer to your data when answering this question.) summarize any difficulties or problems you had in performing the experiment that might have affected the results. describe how you might change the procedure to avoid these problems. give at least one more example of newton's third law in everyday life.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 08:20
Which is not a characteristic of bacteria? a. they are unicellular. b. they are prokaryotic. c. they are the smallest form of life on earth. d. they are multicellular.
Answers: 2
![question](/tpl/images/cats/biologiya.png)
You know the right answer?
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATG...
Questions
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 12.05.2021 20:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/himiya.png)
Chemistry, 12.05.2021 20:50
![question](/tpl/images/cats/mat.png)
Mathematics, 12.05.2021 20:50
![question](/tpl/images/cats/mat.png)
Mathematics, 12.05.2021 20:50
![question](/tpl/images/cats/en.png)
English, 12.05.2021 20:50
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/en.png)
English, 12.05.2021 20:50
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 12.05.2021 20:50
![question](/tpl/images/cats/biologiya.png)
Biology, 12.05.2021 20:50
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 12.05.2021 20:50
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 12.05.2021 20:50
![question](/tpl/images/cats/mat.png)
Mathematics, 12.05.2021 20:50