Biology, 31.01.2020 10:55 hlc614

Mountains formed b two colliding continents often contain marine rocks

Answers: 1

Show answers

Answers

Answer from: Quest

fertilization, pictured in figure 24.23a is the process in which gametes (an egg and sperm) fuse to form a zygote. the egg and sperm each contain one set of chromosomes. to ensure that the offspring has only one complete diploid set of chromosomes, only one sperm must fuse with one egg. in mammals, the egg is protected by a layer of extracellular matrix consisting mainly of glycoproteins called the zona pellucida. when a sperm binds to the zona pellucida, a series of biochemical events, called the acrosomal reactions, take place. in placental mammals, the acrosome contains digestive enzymes that initiate the degradation of the glycoprotein matrix protecting the egg and allowing the sperm plasma membrane to fuse with the egg plasma membrane, as illustrated in figure 24.23b. the fusion of these two membranes creates an opening through which the sperm nucleus is transferred into the ovum. the nuclear membranes of the egg and sperm break down and the two haploid genomes condense to form a diploid genome.

explanation:

Answer from: Quest

When you are making a guess you are forming a hypothesis

Answer from: Quest

1. amino acid refers to the fundamental building block of proteins, comprising of an amino group and a carboxyl group.

2. catalyst refers to any substance, which increases the rate of chemical reaction without being used up in the reaction.

3. a complex molecule containing he genetic code is dna or deoxyribonucleic acid.

4. an enzyme refers to a molecule of protein, which is unique in accelerating up a particular chemical reaction in the biological systems.

5. nucleic acid refers to an sequence of sugars, phosphates, and nitrogenous bases, for example, dna and rna.

6. a protein refers to a large, composite organic molecule comprising of a huge number of amino acids associated together with the of peptide bonds.

7. rna refers to a nucleic acid that takes part in the production of proteins.

8. substrate refers to a compound, which takes part in a chemical reaction, and is chemically modified by the reaction.

Answer from: Quest

c is the correct answer!

Another question on Biology

Biology, 22.06.2019 04:30

What are the three types of counseling established by marine corps policy?

Answers: 1

Answer

Biology, 22.06.2019 07:30

Paint and solvents pose no potential hazard to human health. select the best answer from the choices provided t f

Answers: 3

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

Biology, 22.06.2019 14:30

What is a difference between systemic and pulmonary circulation? a. systemic circulation carries oxygenated blood to the lungs and pulmonary circulation carries deoxygenated blood to the body. b. systemic circulation carries deoxygenated blood to the lungs and pulmonary circulation carries oxygenated blood to the body. c. systemic circulation carries deoxygenated blood to the body and pulmonary circulation carries oxygenated blood to the lungs. d. systemic circulation carries oxygenated blood to the body and pulmonary circulation carries deoxygenated blood to the lungs.

Answers: 1

Answer

You know the right answer?

Mountains formed b two colliding continents often contain marine rocks...

Questions