Which accurately describes the function of the electron transport system (ets)?
a.
it...
Which accurately describes the function of the electron transport system (ets)?
a.
it metabolizes pyruvic acid to form atp, nadh, and fadh2. both nadh and fadh2 are then used to make four molecules of adp using electron transfer. the stroma of the cell is the site of this cyclical process.
b.
it takes 6-carbon sugar molecules made during the krebs cycle and uses them to make adp. the ets takes place in the granum of the mitochondria and provides 16 molecules of adp for every one glucose molecule that enters glycolysis.
c.
it takes electron carrier molecules made during glycolysis and the krebs cycle and uses them to make atp. the ets takes place in the cristae of the mitochondria and provides 34 molecules of atp for every one glucose molecule that enters glycolysis.
d.
it breaks down a 6-carbon sugar into two 3-carbon pyruvic acid molecules. for each 6-carbon sugar, two molecules of atp and one molecule of nadh are formed. this process takes place in the thylakoid membrane.
Answers: 1
Biology, 22.06.2019 02:00
Study the diagram of a cell. which structure is found only in plant cells and functions in the process of photosynthesis? w x y z
Answers: 3
Biology, 22.06.2019 07:00
Give an example of a trait that is controlled by more than one gene.
Answers: 1
Biology, 22.06.2019 10:10
Which example describes a mutualistic relationship between organisms? young wasps prey on caterpillars. crabs eat the remains of dead fish. tapeworms feed on food in the intestines of cats ants protect a tree on which they feed.
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Mathematics, 23.09.2020 05:01
Mathematics, 23.09.2020 05:01
Biology, 23.09.2020 05:01
Social Studies, 23.09.2020 05:01
Mathematics, 23.09.2020 05:01
Mathematics, 23.09.2020 05:01
Mathematics, 23.09.2020 05:01
Mathematics, 23.09.2020 05:01
Mathematics, 23.09.2020 05:01
History, 23.09.2020 05:01
Mathematics, 23.09.2020 05:01
Mathematics, 23.09.2020 05:01