Identify the degree of comparison of the underlined word for questions 5-8.
5) the new gymnas...
Identify the degree of comparison of the underlined word for questions 5-8.
5) the new gymnasium is larger than the one we used to have
a) positive
b) comparative
c) superlative
d) none of the above
6) it is by far the biggest building on campus.
a) positive
b) comparative
c) superlative
d) none of the above
7) there is a beautiful mural over the door depicting a variety of sports.
a) positive
b) comparative
c) superlative
d) none of the above
8) inside is a display case full of team trophies.
a) positive
b) comparative
c) superlative
d) none of the above
will give brainliest!
Answers: 1
Biology, 21.06.2019 15:00
The central dogma of molecular biology is centered upon the process of protein synthesis, in which the information from dna is transcribed and translated, resulting in multiple amino acids being joined to form a)lipidsb)proteinsc)carbohydratesd)nucleic acids
Answers: 3
Biology, 22.06.2019 08:10
What is the next step in the process after a substrate enters the active site of an enzyme
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:30
50 points! which of the following is an inference? a burning candle is extinguished when it is covered with a jar. the candle burns longer than expected in a jar that has a plant in it. a plant lives longer than expected in a jar that has a burning candle. there is more oxygen in the jar because there is a plant in it.
Answers: 2
Computers and Technology, 11.11.2019 21:31