subject
Biology, 01.10.2019 11:30 Chicagofire28

Why don't the present shapes of the continents fit perfectly into a supercontinent in pangea?

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 21:30
List the advantages and disadavantages of the switch from persistent chlorinated hydrocarbon pesticides (such as ddt) to nonpersistent organophosphate pesicides. have the benefits of the switch outweighed the disadvantages? explain.
Answers: 3
question
Biology, 22.06.2019 03:30
Recombinant dna (rdna) creates offspring which are genetically identical to the parent is the process of breeding only organisms with desirable traits involves the removal of the nucleus of a cell combines genes from organisms of different species in a lab
Answers: 1
question
Biology, 22.06.2019 06:30
If animal agriculture was eliminated, how much grain would become available for human consumption?
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Why don't the present shapes of the continents fit perfectly into a supercontinent in pangea?...
Questions
question
Chemistry, 17.07.2019 06:40
Questions on the website: 13722367