subject
Biology, 31.08.2019 01:30 CoolRahim9090

If you looked under a micropscope and saw a cell with a cell wall and chloroplasts, you would know that the cell is

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 13:00
If a fungus a plant take up water and nutrients, that would be an example of which type of relationship? a. commensalism b. symbiotic mutualism c. predation d. parasitism
Answers: 2
question
Biology, 21.06.2019 21:30
How do accessory pigments chlorophyll?
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:00
Is dna the same in every cell in the human body explain your answer
Answers: 2
You know the right answer?
If you looked under a micropscope and saw a cell with a cell wall and chloroplasts, you would know t...
Questions
question
History, 08.07.2019 01:00
question
Biology, 08.07.2019 01:00
question
Computers and Technology, 08.07.2019 01:00
question
Mathematics, 08.07.2019 01:00
Questions on the website: 13722362