subject
Biology, 30.09.2019 14:30 cjacobs77311

Me !

list at least three (3) characteristics of carbon that make it a unique element.

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 16:30
Dna is always read in the whereas rna is read in .
Answers: 2
question
Biology, 22.06.2019 04:00
The transport tubes from food came down the plant are called?
Answers: 1
question
Biology, 22.06.2019 07:30
1. seamount a raised footwall block between normal fault creates this 2. syncline break between rocks where a hanging wall rises relative to a footwall 3. hot spring on rolling hills, this a dip between hills 4. volcanic neck created when a block with hanging walls slips down between normal faults 5. caldera underwater volcano that never reaches above sea level 6. horst natural hot water on earth's surface containing many minerals 7. graben underwater volcano whose top is eroded flat by waves 8. crater less than a mile in diameter; looks like a bowl at the top of a volcano 9. guyot magma that filled the central vent that remains after the volcano has eroded 10. reverse fault over 1 mile in diameter; looks like a bowl over a volcano
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Me !

list at least three (3) characteristics of carbon that make it a unique element....
Questions
question
History, 12.02.2021 19:10
question
Mathematics, 12.02.2021 19:10
question
Mathematics, 12.02.2021 19:10
question
Mathematics, 12.02.2021 19:10
question
Mathematics, 12.02.2021 19:10
question
Arts, 12.02.2021 19:10
Questions on the website: 13722363