PLEASE HELP WILL GIVE BRAINLIEST Why is it healthier for western
forests to endure frequent but small wildfires than one immense catastrophic forest fire?

Quick asap will give brainiest ! what best describes the same pattern of tides on earth throughout the day? neap tides spring tides semidiurnal tides nocturnal tides

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Read the article and use the information to answer the questions that follow discovering the structure of dna explain how the discoveries by rosalind franklin watson and crick build an accurate model of dna done