Answers: 1
Biology, 21.06.2019 23:10
(drag each tile to the correct location.) categorize each term as something that is typical of a scientific theory, a scientific hypothesis, or both. - a tentative statement used to guide scientific investigations. - makes predictions about future events. - can be tested by many independent researchers. - based on observations of natural phenomena. - a well-established, highly reliable explanation.
Answers: 1
Biology, 22.06.2019 07:00
Which best describes a gene? a. a sister chromatid b. a chromosome c. a tetrad d. a piece of a chromosome
Answers: 2
Biology, 22.06.2019 09:00
Dan made the table shown to describe two different relationships between animals. organism interactions relationship a relationship b one organism lives inside the organism it feeds off no organism is harmed which of the following statements is most likely correct?
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
What is photosynthesis...
Mathematics, 18.12.2020 01:50
Mathematics, 18.12.2020 01:50
Mathematics, 18.12.2020 01:50
Mathematics, 18.12.2020 01:50
Arts, 18.12.2020 01:50
Mathematics, 18.12.2020 01:50