Biology, 27.04.2021 04:30 Manuel2019
Os membros superiores e inferiores garantem respectivamente ao indivíduo a capacidade de escrever e obtenção de objetos, sustentação do corpo e mobilidade. São formados por ossos longos e curtos que garantes estas funções. Com relação aos ossos dos membros assinale V para verdadeiro e F para falso. (1,0)
( ) A escápula apresenta a cavidade glenóide que articula a cabeça do úmero, acrômio que articula a clavícula e processo coronóide que também serve de inserção de músculos e ligamentos.
( ) O tubérculo da clavícula possui posição póstero-inferior.
( ) O úmero apresenta na face anterior a tuberosidade deltóidea, onde se insere o tendão do músculo deltoide.
( ) A ulna apresenta anteriormente a incisura troclear que se articula com o capítulo do úmero. Medialmente apresenta a incisura radial onde articula a cabeça do rádio.
( ) Na face anterior do rádio está a tuberosidade do rádio. Na epífise distal lateralmente está um processo denominado de estilóide do rádio.
( ) O osso do quadril apresenta superiormente a crista ilíaca, posteriormente a este a tuberosidade ilíaca, abaixo desta está a face auricular. Na extremidade anterior do osso pube e abaixo está a face sinfisial. Na face lateral do osso do quadril está uma cavidade grande denominada de acetábulo.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 17:30
Describe how viruses and bacteria can be used as biological weapons. what are some of the potential threats and potential benefits? do you agree with the use of viruses and bacteria as biological weapons? why or why not?
Answers: 1
Biology, 22.06.2019 20:30
The hershey and chase experiments involved the preparation of two different types of radioactively labeled phage. which of the following best explains why two preparations were required? a. the bacteriophage used in the experiments was a t2 phage. b. it was necessary that each of the two phage components, dna and protein, be identifiable upon recovery at the end of the experiment. c. each scientist had his own method for labeling phage, so each conducted the same experiment using a different isotope. d. establishing the identity of the genetic material required observation of two phage generations.
Answers: 2
Os membros superiores e inferiores garantem respectivamente ao indivíduo a capacidade de escrever e...
Mathematics, 05.09.2020 16:01
Mathematics, 05.09.2020 16:01
History, 05.09.2020 16:01
Biology, 05.09.2020 16:01
Mathematics, 05.09.2020 16:01
Social Studies, 05.09.2020 16:01
English, 05.09.2020 16:01