Biology, 28.04.2021 21:20 dmarte11092001
Why are populations with high levels of genetic diversity more stable than populations with low levels of genetic diversity?
A.
Populations with high levels of genetic diversity are more likely to have individuals that will undergo
natural selection if conditions
change.
B. Populations with high levels of genetic diversity are
to more likely to have individuals with traits that help them survive if conditions
change.
X
C. Populations with high levels of genetic diversity are less likely to interbreed with other populations.
D.
Populations with high levels of genetic diversity are less likely to have high levels of variation in
alleles.
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 23:50
30 points why are most volcanoes found around the ring of fire? this is a location where there are many hot spots. this is a location of numerous plate boundaries. this is a location within an active oceanic plate. this is a location of fast moving continental crust.
Answers: 1
Biology, 23.06.2019 04:00
If the temperature in an area drops five degrees between one day and the next, has the climate of the area changed? explain.
Answers: 2
Biology, 23.06.2019 07:30
Acell had damaged dna. which checkpoint is responsible for checking this
Answers: 2
Why are populations with high levels of genetic diversity more stable than populations with low leve...
Mathematics, 30.10.2020 02:50
History, 30.10.2020 02:50
Computers and Technology, 30.10.2020 02:50
Biology, 30.10.2020 02:50
Mathematics, 30.10.2020 02:50
Social Studies, 30.10.2020 02:50
Chemistry, 30.10.2020 02:50
Mathematics, 30.10.2020 02:50
English, 30.10.2020 02:50
Mathematics, 30.10.2020 02:50
Physics, 30.10.2020 02:50
Mathematics, 30.10.2020 02:50
History, 30.10.2020 03:00
Spanish, 30.10.2020 03:00