Protists are
A. the simplest of eukaryotes
B. members of a single kingdom
C. the simple...
![subject](/tpl/images/cats/biologiya.png)
Biology, 13.05.2021 04:30 hellodarkness14
Protists are
A. the simplest of eukaryotes
B. members of a single kingdom
C. the simplest of eukaryotes, and are generally aquatic
D. the simplest of eukaryotes, generally aquatic, and members of a single kingdom
E. generally aquatic
![ansver](/tpl/images/cats/User.png)
Answers: 3
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 01:20
Transmission electron microscope are best for viewing a) microorganisms in pond water b) internal organs of a mouse c)internal structures of a cell d) surface features of a specimen
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 05:00
Jason adds the antibiotic penicillin to a bacterial culture. the bacteria develop genetic modifications in their genome, which gives them resistance to the antibiotic penicillin. what caused this genetic modification?
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Questions
![question](/tpl/images/cats/biologiya.png)
Biology, 14.06.2020 16:57
![question](/tpl/images/cats/mat.png)
Mathematics, 14.06.2020 16:57
![question](/tpl/images/cats/mat.png)
Mathematics, 14.06.2020 16:57
![question](/tpl/images/cats/ekonomika.png)
Business, 14.06.2020 16:57
![question](/tpl/images/cats/biologiya.png)
Biology, 14.06.2020 16:57
![question](/tpl/images/cats/health.png)
Health, 14.06.2020 16:57
![question](/tpl/images/cats/health.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 14.06.2020 16:57
![question](/tpl/images/cats/mat.png)
Mathematics, 14.06.2020 16:57
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 14.06.2020 16:57
![question](/tpl/images/cats/fr.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/health.png)
![question](/tpl/images/cats/en.png)
English, 14.06.2020 16:57
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 14.06.2020 16:57
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 14.06.2020 16:57