subject
Biology, 17.05.2021 19:50 uh8hardiek

Write the tRNA sequence for the given strand of mRNA AGGUCAUGCAUGGGCAUGCAU

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 14:30
5) these are organisms where the genetic material is not bound by a nucleus. they are usually unicellular.
Answers: 1
question
Biology, 22.06.2019 04:30
Taq polymerase is an enzyme isolated from the organism thermophilus aquaticus. this organism has been found living in the hot springs of yellowstone national park. this enzyme is used to copy human dna from crime scenes. most reactions are performed at ranges similar to those of the human body; however, what considerations should be made for optimum use of this enzyme? view available hint(s)taq polymerase is an enzyme isolated from the organism thermophilus aquaticus. this organism has been found living in the hot springs of yellowstone national park. this enzyme is used to copy human dna from crime scenes. most reactions are performed at ranges similar to those of the human body; however, what considerations should be made for optimum use of this enzyme? the enzyme will not work on human dna.nothing should be altered.the ph should be decreased.the temperature should be raised.
Answers: 2
question
Biology, 22.06.2019 14:00
Homo heidelbergensis was a tall, muscular hunter, who used both tools and weapons. because h. heidelbergensis was not a gatherer/forager, but ate a varied diet including meat and fish, we would expect to see what anatomical changes?
Answers: 1
question
Biology, 22.06.2019 15:00
What process decreases the salinity of ocean water? decreased precipitationdecreased melting of glaciersincreased evaporationincreased runoff from rivers
Answers: 1
You know the right answer?
Write the tRNA sequence for the given strand of mRNA AGGUCAUGCAUGGGCAUGCAU...
Questions
question
Mathematics, 02.04.2020 22:00
question
Biology, 02.04.2020 22:01
question
Mathematics, 02.04.2020 22:01
question
English, 02.04.2020 22:02
question
Biology, 02.04.2020 22:02
Questions on the website: 13722361