Write the tRNA sequence for the given strand of mRNA 7. AGGUCAUGCAUGGGCAUGCAU 8.AGAGAUUCAGCUAGCACGAUA I​

lunar landing mission. apollo 11 was the first manned mission to land on the moon. the first steps by humans on another planetary body were taken by neil armstrong and buzz aldrin on july 20, 1969. the astronauts also returned to earth the first samples from another planetary body.

explanation:

a scenario where a cell may be needed to perform a form of endocytosis is when transporting large molecules. a scenario where a cell may be needed to perform a form of exocytosis is when releasing the large molecule from the cell.

passive transport is a movement of biochemicals and other atomic or molecular substances across cell membranes without need of energy input. unlike active transport, it does not require an input of cellular energy because it is instead driven by the tendency of the system to grow in entropy.

so, according to what that says, i believe it's hypertonic and hypotonic.

good luck!