Please write a poem. Will give brainilist.
Screenshot with instructions attached.
No links or...
![subject](/tpl/images/cats/biologiya.png)
Biology, 27.05.2021 19:20 alanaruth3389
Please write a poem. Will give brainilist.
Screenshot with instructions attached.
No links or jokes cause i actually need help.
![ansver](/tpl/images/cats/User.png)
Answers: 3
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 13:30
Ameadow ecosystem includes many species of grasses and small shrubs, several herbivores, and a few carnivores. a fungus colonizes the meadow and kills most of its vegetation. what is most likely to happen to the populations of herbivores and carnivores in the ecosystem? a. the populations of herbivores and carnivores will increase because there will be less competition for chemical energy. b. the populations of herbivores and carnivores will remain stable because the fungus cannot infect these organisms. c. the populations of herbivores will decrease because of vegetation loss, but the population of carnivores will remain stable. d. the populations of herbivores and carnivores will decline because less chemical energy will be stored in the ecosystem.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 03:30
Which type of respiration takes place when there is no oxygen present
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 10:00
Dna and rna share a number of similarities,but they also differ in certain aspects of their structure. wich nitrogenous base is found in rna but is not found in dna
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Questions
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 17.06.2021 16:20
![question](/tpl/images/cats/mat.png)
Mathematics, 17.06.2021 16:20
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 17.06.2021 16:20
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 17.06.2021 16:20
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 17.06.2021 16:20
![question](/tpl/images/cats/en.png)
English, 17.06.2021 16:20
![question](/tpl/images/cats/mat.png)
Mathematics, 17.06.2021 16:20
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 17.06.2021 16:20
![question](/tpl/images/cats/mat.png)
Mathematics, 17.06.2021 16:20
![question](/tpl/images/cats/mat.png)
Mathematics, 17.06.2021 16:20
![question](/tpl/images/cats/es.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 17.06.2021 16:20