subject
Biology, 04.06.2021 05:20 student0724

Help me immediately please​


Help me immediately please​

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 06:00
What element is able to combine with itself and hydrogen to form large molecules ?
Answers: 1
question
Biology, 22.06.2019 07:00
The distant ancestors of tigers may have had bodies without stripes. use the theory of natural selection to explain how tigers may have evolved to have stripes.
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 15:00
Cells control gene expression at which steps
Answers: 1
You know the right answer?
Help me immediately please​
...
Questions
question
Mathematics, 11.10.2021 16:40
Questions on the website: 13722360